A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus

Vestergaard, Gisle and Häring, Monika and Peng, Xu and Rachel, Reinhard and Garrett, Roger A. and Prangishvili, David (2005) A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus. Virology 336 (1), pp. 83-92.

Full text not available from this repository.

Abstract

Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

Item Type:Article
Institutions: Biology, Preclinical Medicine > Institut für Biochemie, Genetik und Mikrobiologie > Lehrstuhl für Mikrobiologie > Prof. Dr. Michael Thomm
Identification Number:
ValueType
15866073PubMed ID
10.1016/j.virol.2005.02.025DOI
Classification:
NotationType
Acidianus/virologyMESH
Capsid Proteins/geneticsMESH
DNA, Viral/geneticsMESH
DNA-Binding Proteins/geneticsMESH
Glycosyltransferases/geneticsMESH
Holliday Junction Resolvases/geneticsMESH
Hot Springs/virologyMESH
ItalyMESH
Molecular Sequence DataMESH
Molecular WeightMESH
Nucleoproteins/ultrastructureMESH
Open Reading Frames/geneticsMESH
Rudiviridae/ultrastructureMESH
Sequence Analysis, DNAMESH
Sequence Homology, Amino AcidMESH
Terminal Repeat Sequences/geneticsMESH
Thymidylate Synthase/geneticsMESH
Viral Proteins/isolation & purificationMESH
Viral Tail Proteins/ultrastructureMESH
Water MicrobiologyMESH
Subjects:500 Science > 570 Life sciences
Status:Published
Refereed:Unknown
Created at the University of Regensburg:Unknown
Owner:Gertraud Kellers
Deposited On:19 Mar 2010 10:54
Last Modified:19 Mar 2010 10:54
Item ID:13527
Owner Only: item control page